GStr clear fix?

Author: gpertea

GStr.cpp

@@ -50,9 +50,11 @@ GStr::Data* GStr::new_data(const char* str, uint addcap) {
 
 void GStr::prep_data(uint len, uint addcap) {
 
-    if (len+addcap == my_data->cap && my_data->ref_count <= 1)
+    if (len+addcap <= my_data->cap && my_data->ref_count <= 1) {
+    	my_data->length=len;
+    	my_data->chars[len]=0;
         return;
-
+    }
     if (my_data != &null_data && --my_data->ref_count == 0)
         GFREE(my_data);
 
@@ -67,6 +69,14 @@ void GStr::prep_data(uint len, uint addcap) {
         my_data = &null_data;
 }
 
+GStr& GStr::clear(int init_cap) {
+  make_unique(); //edit operation ahead
+
+  prep_data(0, init_cap);
+  return *this;
+  }
+
+
 void GStr::replace_data(Data *data) {
     if (my_data != &null_data && --my_data->ref_count == 0)
         GFREE(my_data);
@@ -215,7 +225,7 @@ GStr& GStr::operator=(const char *s) {
   if (s==NULL) {
     prep_data(0);
     return *this;
-    }
+  }
   const int len = ::strlen(s); prep_data(len);
   ::memcpy(my_data->chars, s, len);
   return *this;
@@ -343,12 +353,6 @@ GStr GStr::copy() const {
  return newstring;
  }
 
-GStr& GStr::clear() {
-  make_unique(); //edit operation ahead
-  prep_data(0);
-  return *this;
-  }
-
 int GStr::index(const GStr& s, int start_index) const {
  return index(s.chars(), start_index);
  }

GStr.h

@@ -104,7 +104,7 @@ class GStr {
 
         GStr& upper();
         GStr& lower();
-        GStr& clear();//make empty
+        GStr& clear(int init_cap=0);//make empty, but can specify initial capacity
         //character translation or removal:
         GStr& tr(const char* from, const char* to=NULL);
         //number of occurences of a char in the string:
@@ -184,10 +184,11 @@ class GStr {
               };
         static Data* new_data(uint len, uint addcap=0); //alloc a specified length string's Data
         static Data* new_data(const char* str, uint addcap=0); //alloc a copy of a specified string, with an additional cap
-        void prep_data(uint len, uint addcap=0); //allocates memory for the string
+        void prep_data(uint len, uint addcap=0); //allocates memory for the string, if needed
         void replace_data(Data* data);
+        //WARNING (dangerous): direct access to pointer; string editing cannot change the length!
+        char* chrs();
         void make_unique();
-        char* chrs(); // this is dangerous, length should not be affected
         static Data null_data; //a null (empty) string Data is available here
         Data* my_data; //pointer to a Data object holding actual string data
 };
@@ -203,7 +204,7 @@ inline const char *GStr::chars() const {
  return my_data->chars;
  }
 
-inline char *GStr::chrs() { //protected version, allows modification of the chars
+inline char *GStr::chrs() { //allows direct modification of the chars !
  return my_data->chars;
  }
 

codons.cpp

@@ -51,7 +51,7 @@ unsigned short packCodon(char n1, char n2, char n3) {
  byte b1=n1-'A';
  byte b2=n2-'A';
  byte b3=n3-'A';
- b1 |= (b2 << 5); 
+ b1 |= (b2 << 5);
  b2 = (b2 >> 3) | (b3 << 2);
  return ( ((unsigned short)b2) << 8) + b1;
  }
@@ -62,7 +62,7 @@ bool codonTableInit() {
  for (int i=0;i<cdsize;i+=4) {
    unsigned short aacode=packCodon(codonData[i], codonData[i+1], codonData[i+2]);
    codonTable[aacode]=codonData[i+3];
-   } 
+   }
  return true;
  }
 
@@ -88,3 +88,9 @@ char* translateDNA(const char* dnastr, int& aalen, int dnalen) {
    }
  return r;
 }
+
+char translateCodon(const char* dna) { //returns the aminoacid code for the 1st codon at dna
+	if (dna==NULL) return 0;
+	if (dna[0]==0 || dna[1]==0 || dna[2]==0) return 0;
+    return codonTable[packCodon(toupper(dna[0]),toupper(dna[1]),toupper(dna[2]))];
+}

codons.h

@@ -26,20 +26,20 @@ struct Codon {
    nuc[1]=toupper(s2);
    nuc[2]=toupper(s3);
    }
- 
-   
+
+
  char& operator[](int idx) {
-   if (idx<0 || idx>2) 
+   if (idx<0 || idx>2)
       GError("Error: Codon index out of bounds!\n");
    return nuc[idx];
    }
 
  char operator[](int idx) const {
-   if (idx<0 || idx>2) 
+   if (idx<0 || idx>2)
       GError("Error: Codon index out of bounds!\n");
    return nuc[idx];
    }
- 
+
  char translate();
  };
 
@@ -48,7 +48,8 @@ struct Codon {
 // responsible for freeing the returned string!
 char* translateDNA(const char* dnastr, int& aalen, int dnalen=0);
 
+char translateCodon(const char* dna); //returns the aminoacid code for the 1st codon at dna
 
 bool codonTableInit();
- 
+
 #endif

gdna.cpp

@@ -3,8 +3,8 @@
 
 const char* IUPAC_2BIT  ="AACCTTGGTTAAAAAACCCCGGAAAAAACCAAAAAA";
 const char* IUPAC_2BITN ="001133223300000011112200000011000000";
-const char* IUPAC_DEFS  ="AaCcTtGgUuMmRrWwSsYyKkVvHhDdBbNnXx-*";
-const char* IUPAC_COMP  ="TtGgAaCcAaKkYyWwSsRrMmBbDdHhVvNnXx-*";
+const char* IUPAC_DEFS ="AaCcTtGgUuMmRrWwSsYyKkVvHhDdBbNnXx-*";
+const char* IUPAC_COMP ="TtGgAaCcAaKkYyWwSsRrMmBbDdHhVvNnXx-*";
 
 #define A_2BIT 0 // 00
 #define C_2BIT 1 // 01

gdna.h

@@ -2,6 +2,9 @@
 #define GDNA_H
 #include "GBase.h"
 
+extern const char* IUPAC_DEFS;
+extern const char* IUPAC_COMP;
+
 char ntComplement(char c);
 
 //in-place reverse complement of a nucleotide (sub)sequence